Read MR0000920155

Accession MR0000920155
Sequence 
ucuugucaauguuuaggggc
Organism Physcomitrella patens
Stem-loop ID ppt-MIR904a ppt-MIR904b
Mature ID ppt-miR904a ppt-miR904b

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000213 7 whole body GEO : GSM115095 7 day wild-type protonemata [ Axtell MJ et al.]
ER0000000214 21 gametophore GEO : GSM115096 14 day old wild-type P. patens -- Protonemata and young Gametophores [ Axtell MJ et al.]
ER0000000215 70 gametophore GEO : GSM115097 ~60 day old wild-type mature gametophores and sporophytes [ Axtell MJ et al.]

References

1
PMID : 17601824
  • "Common functions for diverse small RNAs of land plants"
    • Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).