Read MR0000913606

Accession MR0000913606
Sequence 
agccaaggaugacuugccug
Organism Arabidopsis thaliana
Stem-loop ID ath-MIR169a ath-MIR169b ath-MIR169c ath-MIR169d ath-MIR169e ath-MIR169f ath-MIR169g ath-MIR169h ath-MIR169i ath-MIR169j ath-MIR169k ath-MIR169l ath-MIR169m ath-MIR169n
Mature ID ath-miR169a ath-miR169b ath-miR169c ath-miR169d ath-miR169e ath-miR169f ath-miR169g-5p ath-miR169h ath-miR169i ath-miR169j ath-miR169k ath-miR169l ath-miR169m ath-miR169n

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000208 1 flower GEO : GSM118372 [ Rajagopalan R et al.]
ER0000000210 1 seedling GEO : GSM118374 [ Rajagopalan R et al.]

References

1
PMID : 17182867
  • "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
    • Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).