Read MR0000894621

Accession MR0000894621
Sequence 
aggcccgaucuugaggcagga
Organism Oryza sativa
Stem-loop ID osa-MIR1861a osa-MIR1861b osa-MIR1861f osa-MIR1861h osa-MIR1861j osa-MIR1861l osa-MIR1861n
Mature ID osa-miR1861a osa-miR1861b osa-miR1861f osa-miR1861h osa-miR1861j osa-miR1861l osa-miR1861n

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000202 21 whole body GEO : GSM571078 strain: indica 93-11, stress: H2O2 [ Li T et al.]

References

1
PMID : 21113019
  • "Identification and analysis of seven H(2)O(2)-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica)"
    • Li T, Li H, Zhang YX, Liu JY Nucleic Acids Res. 39:2821-2833(2011).