Read MR0000849262

Accession MR0000849262
Sequence 
auaagacgaacgguuaaaguugga
Organism Oryza sativa
Stem-loop ID osa-MIR812k osa-MIR812l osa-MIR812m
Mature ID osa-miR812k osa-miR812l osa-miR812m

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000201 24 whole body GEO : GSM571077 strain: indica 93-11, age: 12-day-old, stress: control [ Li T et al.]
ER0000000202 24 whole body GEO : GSM571078 strain: indica 93-11, stress: H2O2 [ Li T et al.]

References

1
PMID : 21113019
  • "Identification and analysis of seven H(2)O(2)-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica)"
    • Li T, Li H, Zhang YX, Liu JY Nucleic Acids Res. 39:2821-2833(2011).