Read MR0000848567

Accession MR0000848567
Sequence 
uggacugaagggugcucccu
Organism Oryza sativa
Stem-loop ID osa-MIR319a osa-MIR319b
Mature ID osa-miR319a-3p.2-3p osa-miR319b

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000201 20 whole body GEO : GSM571077 strain: indica 93-11, age: 12-day-old, stress: control [ Li T et al.]
ER0000000202 20 whole body GEO : GSM571078 strain: indica 93-11, stress: H2O2 [ Li T et al.]

References

1
PMID : 21113019
  • "Identification and analysis of seven H(2)O(2)-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica)"
    • Li T, Li H, Zhang YX, Liu JY Nucleic Acids Res. 39:2821-2833(2011).