Read MR0000784254

Accession MR0000784254
Sequence 
gaugacaucgcuguuggcaucgaa
Organism Drosophila melanogaster
Stem-loop ID dme-mir-4942
Mature ID dme-miR-4942-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000127 1 ovary GEO : GSM385744 Ovary Somatic Sheet (OSS) cells
ER0000000128 1 ovary GEO : GSM385748 Ovary Somatic Sheet (OSS) cells
ER0000000129 1 ovary GEO : GSM385821 Ovary Somatic Sheet (OSS) cells