Read MR0000782350

Accession MR0000782350
Sequence 
ccucggcuuuacagauauau
Organism Drosophila melanogaster
Stem-loop ID dme-mir-4972
Mature ID dme-miR-4972-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000081 1 whole body GEO : GSM322245 3rd instar larvae
ER0000000128 1 ovary GEO : GSM385748 Ovary Somatic Sheet (OSS) cells
ER0000000129 1 ovary GEO : GSM385821 Ovary Somatic Sheet (OSS) cells