Read MR0000780818

Accession MR0000780818
Sequence 
uaaggagagccccaugccuuugg
Organism Mus musculus
Stem-loop ID mmu-mir-5125

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000052 1 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000059 1 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000063 1 embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000217 1 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000234 1 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000237 1 thymus GEO : GSM539856
ER0000000244 1 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 1 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129
ER0000000257 1 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).