Read MR0000778244

Accession MR0000778244
Sequence 
ugcuuuguggcuuugcuggu
Organism Caenorhabditis elegans
Stem-loop ID cel-mir-4936
Mature ID cel-miR-4936

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000024 3 whole body GEO : GSM378784 [ de Wit E et al.]
ER0000000204 1 adult GEO : GSM604033 strain: N2 wild-type, age: Day 10 [ de Lencastre A et al.]
ER0000000205 2 adult GEO : GSM604034 strain: daf-2(e1379) mutant, age: Day 0 [ de Lencastre A et al.]

References

1
PMID : 19755563
  • "Repertoire and evolution of miRNA genes in four divergent nematode species"
    • de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).
    2
    PMID : 21129974
  • "MicroRNAs both promote and antagonize longevity in C. elegans"
    • de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).