Read MR0000777866

Accession MR0000777866
Sequence 
agccggauccggaugucgcggcga
Organism Drosophila melanogaster
Stem-loop ID dme-mir-4952
Mature ID dme-miR-4952-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000013 2 Kc cell GEO : GSM272653 [ Chung WJ et al.]
ER0000000080 2 whole body GEO : GSM322219 2-4 day old pupae
ER0000000083 5 head GEO : GSM322533 adult female head
ER0000000084 18 head GEO : GSM322543 adult male head
ER0000000101 1 whole body GEO : GSM399107 male body

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).