Read MR0000777862

Accession MR0000777862
Sequence 
gccgccauucgaaucggguag
Organism Drosophila melanogaster
Stem-loop ID dme-mir-4952
Mature ID dme-miR-4952-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000013 1 Kc cell GEO : GSM272653 [ Chung WJ et al.]
ER0000000079 1 whole body GEO : GSM322208 3rd instar larvae
ER0000000080 1 whole body GEO : GSM322219 2-4 day old pupae
ER0000000084 18 head GEO : GSM322543 adult male head
ER0000000088 1 whole body GEO : GSM360262 0-2 day old pupae
ER0000000115 1 head GEO : GSM180328 adult heads (female heads, male heads) [ Ruby JG et al.]

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
    • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).