Read MR0000766385

Accession MR0000766385
Sequence 
ucuuagcuuggcaauaaaauau
Organism Drosophila melanogaster
Stem-loop ID dme-mir-2280
Mature ID dme-miR-2280-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000127 4 ovary GEO : GSM385744 Ovary Somatic Sheet (OSS) cells
ER0000000128 5 ovary GEO : GSM385748 Ovary Somatic Sheet (OSS) cells
ER0000000129 5 ovary GEO : GSM385821 Ovary Somatic Sheet (OSS) cells
ER0000000130 1 ovary GEO : GSM385822 Ovary Somatic Sheet (OSS) cells