Read MR0000762318

Accession MR0000762318
Sequence 
uaucacaguggcuguucuuuuugu
Organism Drosophila melanogaster
Stem-loop ID dme-mir-6-1 dme-mir-6-2 dme-mir-6-3
Mature ID dme-miR-6-3p dme-miR-6-3p dme-miR-6-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000118 5 embryo GEO : GSM180331 early embryo (2-6) [ Ruby JG et al.]
ER0000000119 2 embryo GEO : GSM180332 mid embryo (6-10) [ Ruby JG et al.]
ER0000000120 2 embryo GEO : GSM180333 late embryo (12-24) [ Ruby JG et al.]

References

1
PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
    • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).