Read MR0000760382

Accession MR0000760382
Sequence 
cucuagagggaagcgcuuucug
Organism Homo sapiens
Stem-loop ID hsa-mir-520f hsa-mir-519c hsa-mir-519b hsa-mir-523 hsa-mir-518f hsa-mir-520b hsa-mir-518b hsa-mir-526a-1 hsa-mir-520c hsa-mir-526a-2 hsa-mir-518e hsa-mir-518d hsa-mir-522 hsa-mir-519a-1 hsa-mir-519a-2
Mature ID hsa-miR-519c-5p hsa-miR-519b-5p hsa-miR-523-5p hsa-miR-518f-5p hsa-miR-526a hsa-miR-520c-5p hsa-miR-526a hsa-miR-518e-5p hsa-miR-518d-5p hsa-miR-522-5p hsa-miR-519a-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000114 2 melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]

References

1
PMID : 20300190
  • "Characterization of the Melanoma miRNAome by Deep Sequencing"
    • Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).