Read MR0000744261

Accession MR0000744261
Sequence 
uuacaguuguucaaccaguu
Organism Homo sapiens
Stem-loop ID hsa-mir-582
Mature ID hsa-miR-582-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000107 9 melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000109 3 melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000114 3 melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000262 1 GEO : GSM337570 antibody: anti-Ago1 4B8

References

1
PMID : 20300190
  • "Characterization of the Melanoma miRNAome by Deep Sequencing"
    • Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).