Read MR0000734843

Accession MR0000734843
Sequence
acccguagauccgaacuugug
Organism Homo sapiens
Stem-loop ID hsa-mir-99a hsa-mir-100
Mature ID hsa-miR-99a-5p hsa-miR-100-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000105 6 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000108 2 melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000110 2 melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 2 melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]

References

1
PMID : 20300190
  • "Characterization of the Melanoma miRNAome by Deep Sequencing"
  • Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).