Read MR0000731166

Accession MR0000731166
Sequence 
uucaccaccuucuccacccag
Organism Homo sapiens
Stem-loop ID hsa-mir-197
Mature ID hsa-miR-197-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000104 3 melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 5 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 2 melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 41 melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 15 melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000110 5 melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 11 melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 8 melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 13 melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 8 melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000262 1 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 2 GEO : GSM337571 antibody: anti-Ago2 11A9

References

1
PMID : 20300190
  • "Characterization of the Melanoma miRNAome by Deep Sequencing"
    • Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).