Read MR0000722974

Accession MR0000722974
Sequence 
ugugccuuuggacuacaucgug
Organism Homo sapiens
Stem-loop ID hsa-mir-455
Mature ID hsa-miR-455-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000103 2 melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000108 3 melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 3 melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000266 3 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]

References

1
PMID : 20300190
  • "Characterization of the Melanoma miRNAome by Deep Sequencing"
    • Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
    2
    PMID : 19144710
  • "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas"
    • Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).