Read MR0000712732

Accession MR0000712732
Sequence 
agccuggaagcuggagccugcagug
Organism Homo sapiens
Stem-loop ID hsa-mir-1254-1 hsa-mir-1254-2
Mature ID hsa-miR-1254 hsa-miR-1254

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000103 4 melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 3 melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 2 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 2 melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000110 4 melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 3 melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 3 melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]

References

1
PMID : 20300190
  • "Characterization of the Melanoma miRNAome by Deep Sequencing"
    • Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).