Read MR0000701366

Accession MR0000701366
Sequence 
uacucuggagagugacaaucau
Organism Homo sapiens
Stem-loop ID hsa-mir-514a-1 hsa-mir-514a-2 hsa-mir-514a-3

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000103 43 melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 6 melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000106 3 melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000108 23 melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000110 14 melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 59 melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 30 melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 15 melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]

References

1
PMID : 20300190
  • "Characterization of the Melanoma miRNAome by Deep Sequencing"
    • Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).