Read MR0000665504

Accession MR0000665504
Sequence
cucacucaaggagguugugaug
Organism Drosophila melanogaster
Stem-loop ID dme-mir-307b

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000088 1 whole body GEO : GSM360262 0-2 day old pupae
ER0000000101 1 whole body GEO : GSM399107 male body