Read MR0000665504

AccessionMR0000665504
Sequence
cucacucaaggagguugugaug
OrganismDrosophila melanogaster
Stem-loop ID dme-mir-307b

Experiment

Click the column headings to sort the results table, or restore to the original order.

AccessionRead countTissueLinkCommentReference
ER00000000881Whole bodyGEO : GSM3602620-2 day old pupae
ER00000001011Whole bodyGEO : GSM399107Gender: Male