Read MR0000653317

Accession MR0000653317
Sequence 
uaaaguaaauagucuggauugaugaaa
Organism Drosophila melanogaster
Stem-loop ID dme-mir-987
Mature ID dme-miR-987-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000083 1 head GEO : GSM322533 adult female head
ER0000000084 3 head GEO : GSM322543 adult male head
ER0000000101 1 whole body GEO : GSM399107 male body
ER0000000102 7 S2 cell GEO : GSM371638