Read MR0000649681

Accession MR0000649681
Sequence 
ugggauuuuuuagaucagcaguu
Organism Drosophila melanogaster
Stem-loop ID dme-mir-193
Mature ID dme-miR-193-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000083 2 head GEO : GSM322533 adult female head
ER0000000084 3 head GEO : GSM322543 adult male head
ER0000000115 1 head GEO : GSM180328 adult heads (female heads, male heads) [ Ruby JG et al.]

References

1
PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
    • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).