Read MR0000648272

Accession MR0000648272
Sequence
ucacucaaggagguugugaug
Organism Drosophila melanogaster
Stem-loop ID dme-mir-307b

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000082 1 whole body GEO : GSM322338 2-4 day old pupae
ER0000000100 1 whole body GEO : GSM399106 female body