Read MR0000648272

AccessionMR0000648272
Sequence
ucacucaaggagguugugaug
OrganismDrosophila melanogaster
Stem-loop ID dme-mir-307b

Experiment

Click the column headings to sort the results table, or restore to the original order.

AccessionRead countTissueLinkCommentReference
ER00000000821Whole bodyGEO : GSM3223382-4 day old pupae
ER00000001001Whole bodyGEO : GSM399106Gender: Female