Read MR0000646567

Accession MR0000646567
Sequence 
gguuucacaggaaacugguu
Organism Drosophila melanogaster
Stem-loop ID dme-mir-303
Mature ID dme-miR-303-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000080 1 whole body GEO : GSM322219 2-4 day old pupae
ER0000000093 1 whole body GEO : GSM280085 from 2-4 day old flies
ER0000000099 1 imaginal disc GEO : GSM399105 imaginal disc/brain
ER0000000101 2 whole body GEO : GSM399107 male body