Read MR0000644426

Accession MR0000644426
Sequence 
cagugugguuagcugguugu
Organism Drosophila melanogaster
Stem-loop ID dme-mir-34
Mature ID dme-miR-34-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000079 1 whole body GEO : GSM322208 3rd instar larvae
ER0000000083 2 head GEO : GSM322533 adult female head
ER0000000084 9 head GEO : GSM322543 adult male head
ER0000000100 3 whole body GEO : GSM399106 female body
ER0000000101 3 whole body GEO : GSM399107 male body
ER0000000102 2 S2 cell GEO : GSM371638