Read MR0000542689

Accession MR0000542689
Sequence 
ucuaggacuuuauagagcag
Organism Mus musculus
Stem-loop ID mmu-mir-1929
Mature ID mmu-miR-1929-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000216 1 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000230 1 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000232 1 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000236 1 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000242 1 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 1 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male