Read MR0000461867

Accession MR0000461867
Sequence 
cagugcaaugaugaaagggcaucu
Organism Mus musculus
Stem-loop ID mmu-mir-130b
Mature ID mmu-miR-130b-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000217 1 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 1 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000224 1 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 1 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 2 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000237 2 thymus GEO : GSM539856
ER0000000239 1 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000241 1 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000245 1 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129