Read MR0000457895

Accession MR0000457895
Sequence 
cuccaguauugacugugcugcugaa
Organism Mus musculus
Stem-loop ID mmu-mir-16-1

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000218 1 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000231 1 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000235 1 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 1 spleen GEO : GSM539855 strain: RAG-/-, gender: male