Read MR0000455136

Accession MR0000455136
Sequence 
ccaucaaaguggaggcccucu
Organism Mus musculus
Stem-loop ID mmu-mir-291a mmu-mir-291b
Mature ID mmu-miR-291a-5p mmu-miR-291b-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000063 1 embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000222 1 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000232 26 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 8 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000239 4 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000247 16 GEO : GSM539866 strain: C57BL/6-129
ER0000000256 4 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 2 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).