Read MR0000449648

Accession MR0000449648
Sequence 
ccaucaaaguggaggcccucucu
Organism Mus musculus
Stem-loop ID mmu-mir-291a mmu-mir-291b
Mature ID mmu-miR-291a-5p mmu-miR-291b-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000062 1 embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000247 95 GEO : GSM539866 strain: C57BL/6-129

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).