Read MR0000448892

Accession MR0000448892
Sequence 
gggagccaggaaguauugauguuuc
Organism Mus musculus
Stem-loop ID mmu-mir-505
Mature ID mmu-miR-505-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000062 1 embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000218 3 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 1 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000225 1 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 1 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 5 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 6 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 3 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000234 8 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 3 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 6 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 1 thymus GEO : GSM539856
ER0000000243 2 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000245 2 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 1 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000248 1 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000250 3 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 2 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000253 1 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 1 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 1 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000259 1 ovary GEO : GSM539878 strain: C57BL/6J, gender: female

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).