Read MR0000430708

Accession MR0000430708
Sequence 
ugagguaguagguuguaugguuuuggg
Organism Mus musculus
Stem-loop ID mmu-let-7a-1 mmu-let-7c-1 mmu-let-7c-2
Mature ID mmu-let-7a-5p mmu-let-7c-5p mmu-let-7c-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000058 1 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000218 1 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 5 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000225 23 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 12 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 27 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 12 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 1 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000234 37 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 28 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000237 1 thymus GEO : GSM539856
ER0000000238 9 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 1 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000245 4 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000248 3 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000249 31 heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000251 1 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000253 86 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 82 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 6 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000257 22 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000259 714 ovary GEO : GSM539878 strain: C57BL/6J, gender: female

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).