Read MR0000429099

Accession MR0000429099
Sequence 
agugccgcagaguuuguaguguu
Organism Mus musculus
Stem-loop ID mmu-mir-293
Mature ID mmu-miR-293-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000057 2 embryo GEO : GSM510461 day 9.5 embryo [ Chiang HR et al.]
ER0000000058 8 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 15 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000060 1 embryo GEO : GSM510464 day 9.5 embryo [ Chiang HR et al.]
ER0000000061 9 embryo GEO : GSM510465 day 7.5 embryo [ Chiang HR et al.]
ER0000000062 34 embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000063 33 embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000217 1 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000225 17 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000230 3 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000242 1 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 1 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000247 5282 GEO : GSM539866 strain: C57BL/6-129

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).