Read MR0000415218

Accession MR0000415218
Sequence 
aggucacccguuuuacuauc
Organism Mus musculus
Stem-loop ID mmu-mir-1193
Mature ID mmu-miR-1193-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000054 2 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 2 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).