Read MR0000398115

Accession MR0000398115
Sequence 
gggguuccuggggaugggauuug
Organism Mus musculus
Stem-loop ID mmu-mir-23a
Mature ID mmu-miR-23a-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000052 1 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000216 1 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 1 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000224 1 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 1 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 1 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 2 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 5 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000234 5 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 1 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 3 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000241 2 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 3 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 1 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 1 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000248 1 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).