Read MR0000348099

Accession MR0000348099
Sequence
auguaguugugcaaaucuaug
Organism Mus musculus
Stem-loop ID mmu-mir-19a
Mature ID mmu-miR-19a-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000048 1 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 1 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 2 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000052 1 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000216 1 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
  • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).