Read MR0000341844

Accession MR0000341844
Sequence 
acaaauucguaucuaggggaa
Organism Mus musculus
Stem-loop ID mmu-mir-10a
Mature ID mmu-miR-10a-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000047 1 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000052 1 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000053 1 embryo GEO : GSM510457 Day 12.5 embryo [ Chiang HR et al.]
ER0000000055 6 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000056 1 embryo GEO : GSM510460 day 12.5 embryo [ Chiang HR et al.]
ER0000000062 1 embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000220 1 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 1 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000233 1 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000249 1 heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000251 1 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000255 2 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000259 1 ovary GEO : GSM539878 strain: C57BL/6J, gender: female

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).