Read MR0000324460

Accession MR0000324460
Sequence 
uugugacagauugauaacugaa
Organism Mus musculus
Stem-loop ID mmu-mir-542
Mature ID mmu-miR-542-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000046 1 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000049 1 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000052 1 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000053 1 embryo GEO : GSM510457 Day 12.5 embryo [ Chiang HR et al.]
ER0000000054 1 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 3 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000059 2 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000216 2 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000230 1 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000244 3 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129
ER0000000251 1 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000259 2 ovary GEO : GSM539878 strain: C57BL/6J, gender: female

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).