Read MR0000322050

Accession MR0000322050
Sequence 
cuaauacugccugguaaugaug
Organism Mus musculus
Stem-loop ID mmu-mir-200b mmu-mir-200c
Mature ID mmu-miR-200b-3p mmu-miR-200c-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000045 1 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000047 1 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000049 1 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000052 2 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000253 1 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000255 1 skin GEO : GSM539874 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).