Read MR0000321522

Accession MR0000321522
Sequence 
uugugacagauugauaacug
Organism Mus musculus
Stem-loop ID mmu-mir-542
Mature ID mmu-miR-542-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000045 4 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000049 1 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000052 3 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000231 1 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000244 2 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129
ER0000000257 1 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).