Read MR0000318136

Accession MR0000318136
Sequence 
uguaggucacccguuuuacua
Organism Mus musculus
Stem-loop ID mmu-mir-1193
Mature ID mmu-miR-1193-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000045 1 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000046 1 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000049 1 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 1 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).