Read MR0000309113

Accession MR0000309113
Sequence 
aagcagcauuguacagggcuauc
Organism Mus musculus
Stem-loop ID mmu-mir-103-1 mmu-mir-103-2 mmu-mir-107
Mature ID mmu-miR-103-3p mmu-miR-103-3p mmu-miR-107-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000042 3 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000043 3 whole body GEO : GSM510447 Newborn. [ Chiang HR et al.]
ER0000000045 8 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000046 19 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 15 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 11 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 21 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 18 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 13 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 66 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000057 2 embryo GEO : GSM510461 day 9.5 embryo [ Chiang HR et al.]
ER0000000058 4 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 9 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000060 2 embryo GEO : GSM510464 day 9.5 embryo [ Chiang HR et al.]
ER0000000217 3 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 1 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 3 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000226 1 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000230 8 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 9 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000239 1 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000244 1 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000250 2 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 1 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000252 2 liver GEO : GSM539871 strain: C57BL/6J, gender: male
ER0000000253 1 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000257 1 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 1 testes GEO : GSM539877 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).