Read MR0000308156

Accession MR0000308156
Sequence 
ucaacacuugcugguuuucu
Organism Mus musculus
Stem-loop ID mmu-mir-505
Mature ID mmu-miR-505-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000042 1 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000046 1 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 1 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000050 1 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 2 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 3 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000058 1 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000220 1 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000231 2 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000238 1 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 1 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000243 1 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 6 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000246 3 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129
ER0000000253 1 kidney GEO : GSM539872 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).