Read MR0000307908

Accession MR0000307908
Sequence 
aagcugguaaaauggaacca
Organism Mus musculus
Stem-loop ID mmu-mir-133a-1 mmu-mir-133a-2
Mature ID mmu-miR-133a-5p mmu-miR-133a-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000042 1 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000046 2 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 2 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 3 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 4 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000051 2 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 12 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000249 12 heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000255 1 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 8 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).