Read MR0000306782

Accession MR0000306782
Sequence 
ugguagaccggugacguacacu
Organism Mus musculus
Stem-loop ID mmu-mir-1193
Mature ID mmu-miR-1193-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000042 2 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000046 1 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 4 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 1 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000050 5 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 3 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 1 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000054 7 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 2 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000056 1 embryo GEO : GSM510460 day 12.5 embryo [ Chiang HR et al.]
ER0000000058 1 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000224 2 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000235 1 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 9 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000244 44 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 17 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 23 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000255 2 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 6 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 1 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).