Read MR0000306072

Accession MR0000306072
Sequence 
accacaggguagaaccacggacag
Organism Mus musculus
Stem-loop ID mmu-mir-140
Mature ID mmu-miR-140-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000041 1 whole body GEO : GSM510445 Newborn. [ Chiang HR et al.]
ER0000000042 2 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000043 2 whole body GEO : GSM510447 Newborn. [ Chiang HR et al.]
ER0000000045 4 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000046 5 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 5 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 8 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 4 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 3 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 6 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 31 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000054 2 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 1 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000056 2 embryo GEO : GSM510460 day 12.5 embryo [ Chiang HR et al.]
ER0000000059 2 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000216 46 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 78 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 68 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 42 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 34 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 13 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 4 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 2 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 16 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 18 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 20 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 23 lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 61 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 33 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 19 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 53 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 7 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 38 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 132 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 80 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 13 thymus GEO : GSM539856
ER0000000238 15 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 11 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 8 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 7 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 3 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 20 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 61 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 11 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 8 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 13 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 43 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000249 1 heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000250 2 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 8 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000252 1 liver GEO : GSM539871 strain: C57BL/6J, gender: male
ER0000000253 14 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 3 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 11 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 5 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 6 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 3 testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000259 7 ovary GEO : GSM539878 strain: C57BL/6J, gender: female
ER0000000260 1 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 15 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).