Read MR0000302868

Accession MR0000302868
Sequence 
acucuuucccuguugcacuacug
Organism Mus musculus
Stem-loop ID mmu-mir-130b
Mature ID mmu-miR-130b-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000040 1 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000042 1 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000045 3 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000047 1 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000052 2 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000054 2 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 2 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000058 1 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 2 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000062 4 embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000063 4 embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 5 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 1 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 1 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000224 1 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000227 2 lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 1 lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000232 1 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000236 3 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 3 thymus GEO : GSM539856
ER0000000239 1 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 2 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000244 1 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 1 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).