Read MR0000300550

Accession MR0000300550
Sequence 
caccaucugaaaucgguuau
Organism Mus musculus
Stem-loop ID mmu-mir-29a mmu-mir-29c
Mature ID mmu-miR-29a-3p mmu-miR-29c-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000040 1 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000225 1 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000239 1 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000245 2 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000251 1 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000253 1 kidney GEO : GSM539872 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).