Read MR0000297561

Accession MR0000297561
Sequence 
caguauugacugugcugcugaa
Organism Mus musculus
Stem-loop ID mmu-mir-16-1
Mature ID mmu-miR-16-1-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000040 1 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000042 2 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000043 1 whole body GEO : GSM510447 Newborn. [ Chiang HR et al.]
ER0000000046 2 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000048 2 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000050 1 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 1 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 6 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000054 1 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000216 3 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 2 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 2 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 1 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 1 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000227 1 lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000232 1 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000236 1 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000238 1 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000240 1 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000244 1 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000246 1 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129
ER0000000249 1 heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000257 1 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).